Basic HTML Version
Cotton Genomics and Genetics 2012, Vol.3, No.1, 1
-
7
http://cgg.sophiapublisher.com
6
Genomics Research Center.
3.4
Agrobacterium
-mediated genetic transformation
The de-fuzz seeds were sterilized with alcohol for 30
seconds, and then with hydrogen peroxide
disinfection for 2 hours or 3 hours, finally rinsing
with sterile water with 3 times or 4 times. Using
one-day cultured shoot tip for the infection for 10
min, co-cultured for 2 days. The MS basic medium
with additional IAA 0.1 mg/L KT, 0.2 mg/L, as the
basic culture conditions, while the optimization for
shoot tip culture, the infection time and co-culture
time was carried out.
Taking the same day and three days cultured shoot
apex to be infected when the bacterial concentration
OD
600
value of was 0.5. The infection time set up
10~30 min. Prior to dark cultured for 1 to 4 days, the
shoot apex transferred into induction medium
containing the herbicide (0.1 percent) and cefotaxime
(500 mg /L) , cu l tured in the l ight ing a t 28
℃
.
Experiments were repeated three times to record the
rate of regeneration of explants that grew up green
seedlings. When the shoots grew up 1~2 cm in length
(about 20 days to 30 days), the first subculture were
carried out, followed by 2 times or 3 times for
continuing subcultures until the shoots grew to 3~4 cm
in length (about 30 days to 60 days), then transferred to
rooting medium for rooting (about 30 to 40 days). The
seedlings grew young radicles were transplanted for
seedling recovery. The whole process from seed
disinfection to regenerated plant need to take 3 months
or 5 months.
3.5 Molecular detection of transgenic plants
Total DNA was extracted from the leaves of herbicide-
resistant plants by CTAB method (Paterson, 1993).
PCR analysis for herbicide resistant plants was
carried out by using
SNC1
gene-specific primers
(designed based on the conserved region of its
sequence) and herbicide marker primers. The PCR
reaction volume was 20 μL with 10× Buffer 2.0 μL,
dNTPs, (2.5 mmol/L) 1.6 μL, each primer 0.3 μL,
Taq
DNA polymerase 0.2 μL and adding water to make up
the 20 μL. The reaction procedure was following:
pre-denaturation for 3 min as at 94
℃
, then 30 cycles
with denaturation at 94
℃
for 30 s, annealing at 51
℃
for 45 s (
SNC1
), at 55
℃
for 30 s (
Basta
), extending at
72
℃
for 1 min, finally extending at 72
℃
for 10 min.
Amplified products were scored by 1% agarose gel
electrophoresis. Specific primers for
SNC1
with expected
fragment size about 790 bp were designed as SNC1-F:
5'
-
CCAAACATTTTCAGACTTACAAGACTTG
-
3'
and SNC1-R: 5'
-
AGATGTCCCCGATGTCATCC
-
3';
for herbicide primers with expected fragment size 146 bp
as Basta-F: 5'
-
AGCCCGATGACAGCGACCAC
-
3', and
Basta-R: 5'
-
CGCAACGCCTACGACTGGAC
-
3'.
3.6 T
1
generation of transgenic plants identified by
RT-PCR
Total RNA was extracted from the cotton leaves of
positive T
1
generation plant identified by PCR (Liu et
al., 2006), the SNC1 gene were detected by RT-PCR
using Promega's reverse transcription system.
3.7 Disease resistance of transgenic plants identified
by inoculation
Inoculation method called Culture Pot Wound Root
followed the description of Plant Pathology Research
Methods composed by Fang Zhongda. In accordance
with the ratio (1:1) to mix vermiculite and potting
loam, potting in the plastic culture pots, T
0
generation
cot ton plants, Nine of Zhong35 and seven of
Juanmian 1 hao, respectively, were randomly divided
i n t o 3 g r o up s t o sow t h e i r s e ed s and t he i r
corresponding receptors in the nutrition pots. When
the T
1
generation cottons and controls grew up in 3
leaf stage, the infection with Fusarium oxysporum
strains (provided by Professor Li Guoying from
Shihezi University), of which spore suspension was
diluted to 1.0×10
6
/mL, began to wound the roots for
inoculation. The incidence of genetically modified
cotton plants was recorded after five days infection to
score the number of the incidence and to calculate the
incidence rate.
Acknowledgements
We are very grateful to Dr. Li Xin from University of British
Columbia, Canada, kindly presented SNC1 gene used in this
study. This project was funded by the Transgenic Special
Project (2009ZX08005
-
011B) of the Ministry of Agriculture
of China.