Page 8 - gabVol4No1

Genomics and Applied Biology , 2013, Vol. 4 No.1 1-7
http://gab.sophiapublisher.com
- 5 -
0.8% (w/v) agar (Wako). Plates were sealed and
incubated in 4℃ for 72 h in darkness, then transferred
to growth chamber incubated at 22℃. Light intensity
is 120 μmoL· m-2·s-1. After ten days of growth,
plants were transferred onto rockwool cubes and
grown further with 0.2×MS solution regularly
supplied.
3.2 Yeast two-hybrid (Y2H)
Y2H experiments were performed as previously
described (Tsugama et al., 2012a). cDNA clone
RAFL-18-04-O14 of AtPP2C52 (AT4G03415) was
obtained from RIKEN BRC Experimental Plant
Division (Seki et al., 2002). The open reading frame
(ORF) of AtPP2C52 was amplified by PCR using the
cDNA clone as template and the following primer pair:
5'-CCCGAATTCTCTAGAATGGGGGGTTGTGTGT
CGAC-3' ( EcoRI and XbaI sites are underlined) and
5'-GGGCTCGAGGAGTCTTCGATTTCTCTTCAG
AG-3' ( XhoI site is underlined). The PCR products
were digested by EcoRI and XhoI, and cloned into the
EcoRI/ XhoI site of pGADT7-rec, generating pGAD-
AtPP2C52.
The point mutations of AtPP2C52 gene were
generated by PCR using PrimeSTAR (TaKaRa) with
wild type AtPP2C52 cDNA as template. For the point
mutation of AtPP2C52G99D, PCR was performed using
the following primer pair: G99D-Fw 5' -GTGACA
TTTTGTGATGTATTTGATGGTCATGGTCC-3' and
AtPP2C52-Rv 5'-GAGTCGGATCCTCAAGTCTTC
GATTTCTCTTC-3' ( BamHI site is underlined),
generating 3'-terminus of AtPP2C52G99D. To generate
5'-terminus of AtPP2C52G99D, PCR was performed
using the following primer pair: AtPP2C52-Fw
5'-GAGTCGAATTCATGGGGGGTTGTGTGTC-3'
(Eco RI site is underlined) and G99D-Rv 5'
-GACCATCAAATACACCACAAAATGTCACATCT
TCAGAC-3'. Subsequently, the mixture of 3'- and 5'
-terminus of AtPP2C52 G99D was used as template for
PCR using primer pair AtPP2C52-Fw and AtPP2C52-
Rv, generating full-length AtPP2C52G99D. The PCR
products of AtPP2C52G99D were digested by Eco RI
and BamHI, and cloned into the EcoRI/ BamHI site of
pGADT7-rec, generating pGAD-AtPP2C52G99D. For
the point mutation of AtPP2C52G105D, PCR was
performed using the following primer pair:
G105D-Fw 5'- GATGGTCATGATCCTTATGGCCA
TCTTGTTGCTCG-3' and AtPP2C52-Rv, generating
3'-terminus of AtPP2C52G105D. To generate 5'-
terminus of AtPP2C52G105D , PCR was performed
using the following primer pair: AtPP2C52-Fw and
G105D-Rv 5'-GCCATAAGGATCATGACCATCAA
ATACACCACAAAATG-3'.
Subsequently, the mixture of 3'- and 5'-terminus of
AtPP2C52G105D was used as template for PCR using
primer pair AtPP2C52-Fw and AtPP2C52-Rv,
generating full-length AtPP2C52G105D. The PCR
products of AtPP2C52G105D were digested by EcoRI
and BamHI, and cloned into the EcoRI/Bam HI site of
pGADT7-rec, generating pGAD-AtPP2C52G105D. For
the point mutation of AtPP2C52DGH102-104ERN, PCR
was performed using the following primer pair:
DGH102-104ERN-Fw 5'-GGTGTATTTGAACGTA
ATGGTCCTTATGGCCATCTTG-3' and AtPP2C52-
Rv, generating 3' -terminus of AtPP2C52DGH102-104ERN.
To generate 5'-terminus of AtPP2C52DGH102-104ERN,
PCR was performed using the following primer pair:
AtPP2C52-Fw and DGH102-104ERN-Rv 5'- CATA
AGGACCATTACGTTCAAATACACCACAAAATG
GC-3'. Subsequently, the mixture of 3’ - and 5’-
terminus of AtPP2C52 DGH102-104ERN was used as
template for PCR using primer pair AtPP2C52-Fw
and AtPP2C52-Rv, generating full-length AtPP2C52D-
G-H102-104ERN. The PCR products of AtPP2C52DG-
H102-104ERN were digested by EcoRI and BamHI, and
cloned into the EcoRI/ BamHI site of pGADT7-rec,
generating pGAD-AtPP2C52DGH102-104ERN . These mut-
ations were confirmed by sequencing and then used
for yeast transformation.
Full-length cDNA of UMP1 (AT1G67250) and RD21a
(AT1G47128) were ordered from ABRC and used as
PCR templates for following plasmids construction.
The ORF of UMP1 was amplified by PCR using the
cDNA clone as template and the following primer pair:
5'- GAGTCGAATTCATGGAGTCTGAGAAAAAGA
TAGCTCATG-3' (EcoRI site is underlined) and
5'- GAGTCGGATCCTTACATGAAACTTGGGTAAA
TCGG-3' (Bam HI site is underlined). The PCR
products were digested by Eco RI and BamHI, and
cloned into the EcoRI/ BamHI site of pGADT7-rec,
generating pGAD-UMP1. The ORF of RD21a was
amplified by PCR using the cDNA clone as template
and the following primer pair: 5' -GAGTCGAATTCA
TGGGGTTCCTTAAGCCAACCATGGC -3' (EcoRI
site is underlined) and 5'-GAGTCCCTAGGTTAGGC