Page 7 - Maize Genomics and Genetics

Maize Genomics and Genetics 2012, Vol.3, No.1, 1- 5
ISSN 1925-1971 http://mgg.sophiapublisher.com
4
significantly; Secondly, the positive plants were infected
by pest in the growth stages seriously, especially in
young spike initial stage; Finally, many plant regene-
rations hade the the atavism, Which will make some
difficulties for us to get positive plant seeds. So, we
must improve the positive rate of plantlet regeneration,
and select the excellent plant from a number of positive
plants for genetic analysis and the latter research. At
present, we have obtained some T1 generation seeds,
and we are working at the further analysis of the DNA
extracted from their leaves. The research would
provide a molecular breeding approach for further
improvement of corn starch quality, and a solid
foundation for further application of transgenic maize.
3 Materials and Methods
3.1 Materials used in this research
The plant materials are maize inbred line Y423 (Zea
mays L.) and wheat Chinese Spring (Triticum aestivum
L.). PGM-T vector purchased from Tiangen Company.
The pCAMBIA3301 vector, Agrobacterium EHA105
and E. coli DH5α are preserved by our lab. The major
molecular biology reagents including T4- DNA ligase,
restriction endonuclease, RNA Extraction Kit (RNAiso
Plus D9108A), LA Taq enzyme and cDNA First Strand
Synthesis Kit, and DNA Marker were purchased from
Shanghai Engineering Company and TaKaRa. Other
reagents are belong to the China-made analytical pure.
3.2 Construction of pHorD-GBSS Ⅰplant expression
vector
China Spring Wheat Endosperm RNA is extracted by
RNA extraction kit, and then it was reverse transcribed
into cDNA first strand by reverse transcription kit.
Based on the sequences of D-hordein (EF417989) of
barley and GBSS Ⅰof wheat (AF409085) in Gengbank,
specific primers were designed. Primer sequences as
follows:
HorD-F: 5'-CCGGAATTCCATACGATTTAGGT
GACA-3' EcoRⅠ
HorD-R: 5'- CCCAAGCTTTTCTAGACTCGGT
GGACT-3' HindⅢ
GBSS-F: 5'- CCCAAGCTTATGGCGGCTCTGG
TCACGTC- 3' HindⅢ
GBSS-R: 5'- CTAGCTAGCGCTACAACAAGCG
GCTATCTCCT-3' NheⅠ
The fragments or full-length of HorD and GBSS Ⅰ
were amplified by PCR method, and then the fragments
were connected into pGM-T vector, so the recombinant
plasmids pGM-T-HorD and pGM-T-GBSS Ⅰwere
obtained. The pGM-T-HorD was digested with EcoRⅠ
and HindⅢ, and pGM-T-GBSSI was digested with
Hind Ⅲ and Nhe Ⅰ, and the target fragments were
recycled. The 35S and GUS gene in pCAMBIA3301
vector were digested with EcoRⅠ/NheⅠ. The large
fragments were recycled. The HorD and GBSS Ⅰ
fragments recycled earlier were ligated into expression
vector pCAMBIA3301 with T4-DNA ligase. The
construction process was shown in Figure 7.
3.3 Agrobacterium mediated genetic transformation
of Maize
The plant expression vector pHorD-GBSS Ⅰ was
ligated into Agrobacterium EHA105, then identified
by PCR. Some single colonies were picked out from
the fresh plate and inoculated into the YEP liquid
medium, which containing 50 mg/L Kanamycin, and
shook at 120 r/min until the OD 600 value reach 1.2.
Collected the cells after centrifugation for 15 min at
4℃, and then the Agrobacterium was suspended again
in acetosyringone medium, then was shook until the
value of OD 600 to 0.6, and saved. Then the receptor
was placed into suspension to cultivate 20 min, poured
the liquid, transferred the callus to sterile filter paper
then into the co-culture medium in dark for 3 d at 25℃
after dried the residues bacterial liquid on surface. And
it would be transferred to the bacteriostatic subculture
to recovery culture and transferred to inhibitory
differentiation medium aftre 10 d. The callus began to
green after approximately 15 d differentiation culture,
and regeneration plants were gained after 45 d. Finally,
the plants were transplanted when they were in the
trefoil stage.
3.4 PCR detection of the transgenic plants
Extracted leaves total DNA of regeneration plant by
CTAB method, and designed primers based on the
bar gene. The sequences of primers are as follows:
BAR-F: 5'- TCTGCACCATCGTCAA- 3'; BAR-R:
5'-AAGTCCAGCTGCCAGAA- 3'. According to the
HorD promoter and the partial sequence of GBSS Ⅰ