Basic HTML Version
Molecular Plant Breeding 2012, Vol.3, No.3, 26
-
36
http://mpb.sophiapublisher.com
34
The study of grapevine disease tolerance and defense
has entered the molecular era, which provides both a
theory basis and the genetic tools to describe
grapevine-pathogen interactions as well as discovering
the resistance genes and other defense-related genes.
PR-proteins are the particular class of proteins which
are not expressed in plants without pathogen
interaction or largely induced during infection (Gomès
et al., 2009). The synthetic process of PR-proteins is
one of the major steps in plant defense reaction, and
the diversity of PR-proteins expressed decreases
during ripening, which may be the reason for the
enhanced susceptibility of the berries at the last stages
of ripening (Monteiro et al., 2007).
The large-scale ESTs sequencing provided us useful
information about genes and functions expressed
in the pericarp at the veraison. To explore the
precise functions of genes for understanding the
biological characteristics of non-climacteric fruit,
further analysis and research must be carried out. In
2007, the genome sequencing of
V. vinifera
L cv. Pinot
Noir was completed, and the gene derived from the
library constructed here contributes to the identification
of the complete transcriptome of
V. amurensis
. The
valuable source of cDNA clones can be helpful for
gene mapping by PCR analysis and construction of
high- density arrays for large-scale gene expression
studies. Therefore, the development of the biochemical
and genetic approaches can provide useful tools for
getting more insight on the function of genes.
3 Materials and Methods
3.1 Plant material
V. amurensis
(cv. Shuang Feng, 50% colored) berries
were harvested during summer 2009 in National
V.
amurensis
germplasm resource vineyards. Berries
were frozen immediately in liquid nitrogen in the field
and stored at -80
℃
. The pericarps were used as the
experimental materials.
3.2 RNA extraction
Both cDNA library construction and generation of
ESTs are RNA-based techniques. High quality RNA
was isolated according to the optimized and modified
CTAB protocol.
3.3 Preparation of cDNA library
Refer to the Creator
TM
SMART
TM
Library construction
Kit User Manual for specific steps. 1 μL of total RNA
was used to prepare the first-strand cDNA synthesis.
2 μL of the ss cDNA was used as the template for the
long-distance PCR. The following primers were used
for the PCR: 5'
-
AAGCAGTGGTATCAACGCAGA
GTGGCCATTACGGCCGGG
-
3' (SMART Oligonu-
cleotide), 5'
-
ATTCTAGAGGCCGAGGCGGCCGAC
ATG-d(T)
30
N
-
1
N
-
3' (CDS
Ⅲ
/3' PCR Primer) and
5'
-
AAGCAGTGGTATCAACGCAGAGT
-
3' (5' PCR
Primer). A 5 μL sample of the PCR product was
analyzed on a 1.1% agarose gel.
3 μL ds cDNA was proceeding to proteinase K
treatment, then digested by
Sfi
I. The CHROMA
SPIN-400 Column was prepared for cDNA size
fractionation. And then the ds cDNA extracted and
purified was ligated to the
Sfi
I-digested, dephosp-
horylated pDNR-LIB vector provided with the kit.
The recombinant plasmid was transformed into
E. coli
DH5α by electroporation. The transformation was
made up to 1 mL with LB broth and incubated with
shaking for 1hr at 37
℃
.
3.4 cDNA library screening
The 50 μL dilution was spreaded onto a prewarmed
90 mm LB agar plate containing 30 μg/mL of
chloramphenicol and the agar plate was incubated at
37
℃
overnight. The plates were examined the next
day. The desired transformation mixtures were pooled
to generate the original, unamplified cDNA library.
20 isolated colonies were selected randomly to set up
a PCR reaction using the M13 primers provided to
screen the cDNA library. 5 μL of PCR product was
electrophoresed on a 1.1% agarose gel with DNA size
markers to determine the percentage of recombinant
clones and the insert size. The titer was determined
according to the Creator
TM
SMART
TM
Library
construction Kit User Manual.
3.5 Large-scale EST sequencing and analysis
The BGI Limited was commissioned to be responsible
for the assignment of cDNA library sequencing. The
standard T7 sequencing primers which read into the
presumed 3' end of each cDNA were used in all
sequencing reactions. Sequencing assignment was