Molecular Plant Breeding 2011, Vol.2, No.9, 60
-
67
http://mpb.sophiapublisher.com
67
Continuing table 2
Primer name
Sequence (5′→3′)
Annealing temperature (
℃
)
Semi-RT-PCT
TaSSIIbF
GGCGGGCTTGGAGATGTCGT
56
TaSSIIbR
GAAGGGCGGGGCCTCTAAGAATAC
TaSSIIIbF
TGCAGGGACCACAGTTGATG
56
TaSSIIIbR
TCCCACCTTCTTCCGACTCA
ActF
GCCGTGCTTTCCCTCTATGC
60
ActR
CCTCTCTGCGCCAATCGTGA
Acknowledgements
This research was supported by funds received from the National Natural
Science Foundation of China (No. 31070227) and the CAS/SAFEA
International Partnership Program for Creative Research Teams.
References
Ball S.G., and Morel M.K., 2003, From bacterial glycogen to starch: under-
standing the biogenesis of the plant starch granule, Ann Rev Plant Biol., 54:
207-233 doi:10.1146/annurev.arplant.54.031902.134927 PMid: 14502990
Ball S.G., van de Wal M.H.B.J., and Visser R.G.F., 1998, Progress in
understanding the biosynthesis of amylose, Trends Plant Sci., 3(12):
462-467 doi:10.1016/S1360-1385(98)01342-9
Brunner S., Fengler K., Morgante M., Tingey S., and Rafalsk A., 2005,
Evolution of DNA sequence nonhomologies among maize inbreds, The
Plant Cell, 17: 343-360 doi:10.1105/tpc.104.025627 PMid:15659640
PMCid:548811
Clark J.R., Robertson M., and Ainsworth C.C., 1991, Nucleotide sequence of a
wheat (
Triticum aestivum
L.) cDNA clone encoding the waxy protein, Plant
Mol. Biol., 16(6): 1099-1101 doi:10.1007/BF00016086 PMid:186 3765
Dian W.M., Jiang H.W., Chen Q.S., Liu F.Y., and Wu P., 2003, Cloning and
characteriza- tion of the granule-bound starch synthase II gene in rice: Gene
expression is regulated by the nitrogen level, sugar and circadian rhythm,
Planta, 218(2): 261-268 doi:10.1007/s00425-003-1101-9 PMid: 12955512
Dian W.M., Jiang H.W., and Wu P., 2005, Evolution and expression analysis of
starch synthase III and IV in rice, J. Exp. Bot., 56(412): 623-632 doi:10.
1093/jxb/eri065 PMid:15642712
Force A., Lynch M., Pickett F.B., Amores A., Yan Y.L., and Postlethwait J.,
1999, Preservation of duplicate genes by complementary, degenerative
mutations, Genetics, 151: 1531-1545 PMid:10101175 PMCid:1460548
Gaut B.S., and Doebley J.F., 1997, DNA sequence evidence for the segmental
allotetraploid origin of maize, Proc Natl Acad Sci USA, 94(13): 6809-6814
doi:10.1073/pnas.94.13.6809
Guindon S., and Gascuel O., 2003, A simple, fast and accurate algorithm to
estimate large phylogenies by maximum likelihood, Syst Biol., 52(5):
696-704 doi:10.1080/10635150390235520 PMid:14530136
Guindon S., Lethiec F., Duroux P., and Gascuel O., 2005, PHYML Online a
web server for fast maximum likelihood-based phylogenetic inference,
Nucleic Acids Res., 33: 557-559 doi:10.1093/nar/gki352 PMid:15980534
PMCid:1160113
Harn C., Knight M., Ramakrishnan A., Guan H., Keeling P.L., and Wasserman
B.P., 1998, Isolation and characterization of the
zSSIIa
and
zSSIIb
starch
synthase cDNA clones from maize endosperm, Plant Mol Biol., 37(4):
639-649 doi:10.1023/A:1006079009072 PMid:9687068
Hirose T., and Terao T., 2004, A comprehensive expression analysis of the
starch synthase gene family in rice (
Oryza sativa
L.), Planta, 220(1): 9-16
doi:10.1007/s00425-004-1314-6 PMid:15232694
Jiang H.W., Dian W.M., Liu F.V., and Wu P., 2004, Molecular cloning and
expression analysis of three genes encoding starch synthase II in rice,
Planta, 218(6): 1062-1070 doi:10.1007/s00425-003-1189-y PMid:14740212
Leterrier M., Holappa L.D., Broglie K.E., and Beckles D.M., 2008, Cloning,
characterisa- tion and comparative analysis of a starch synthase IV gene in
wheat: functional and evolutionary implications, BMC Plant Biol., 8: 98
doi:10.1186/1471-2229-8-98 PMid:18826586 PMCid:2576272
Li Z.Y., Chu X.S., Mouille G., Yan L.L., Kosar-Hashemi B., Hey S., Napier J.,
Shewry P., Clarke B., Appels R., Morell M.K., and Rahman S., 1999a, The
localization and expression of the class II starch synthases of wheat, Plant
Physiol., 120: 1147-1156 doi:10.1104/pp.120.4.1147 PMid:10444098
Li Z.Y., Mouille G., Kosar-Hashemi B., Rahman S., Clarke B., Gale K.R.,
Appels R., and Morell M.K., 2000, The structure and expression of the
wheat starch synthase III gene: motifs in the expressed gene define the
lineage of the starch synthase III gene family, Plant Physiol., 123(2):
613-624 doi:10.1104/pp.123.2.613 PMid:10859191 PMCid:59029
Li Z.Y., Rahman S., Kosar-Hashemi B., Mouille G., Appels R., and Morell
M.K., 1999b, Cloning and characterization of a gene encoding wheat
starch synthase I, Theor Appl Genet., 98(8): 1208-1216 doi:10.1007/s00
1220051186
Pan X.X., Tang Y.Y., Li M.R., Wu G.J., and Jiang H.W., 2009, Isoforms of
GBSSI and SSII in four legumes and their phylogenetic relationship to
their orthologs from other angiosperms, J Mol Evol., 69(6): 625-634
doi:10.1007/s00239-009-9300-z PMid:19888543
Paterson A.H., Bowers J.E., and Chapman B.A., 2004, Ancient polyploidization
predating divergence of the cereals, and its consequences for comparative
genomics, Proc Natl Acad Sci USA, 101(26): 9903-9908 doi:10.1073/pnas.
0307901101 PMid:15161969 PMCid:470771
Roldán I., Wattebled F., Mercedes L.M., Delvallé D., Planchot V., Jiménez S.,
Pérez R., Ball S., D'Hulst C., and Mérida A., 2007, The phenotype of
soluble starch synthase IV defective mutants of Arabidopsis thaliana
suggests a novel function of elongation enzymes in the control of starch
granule formation, Plant J., 49(3): 492-504 doi:10.1111/j.1365-313X.2006.
02968.x PMid:17217470
Shimbata T., Nakamura T., Vrinten P., Saito M., Yonemaru J., Seto Y., and
Yasuda H., 2005, Mutations in wheat starch synthase II genes and
PCR-based selection of a SGP-1 null line, Theor Appl Genet., 111(6):
1072-1079 doi:10.1007/s00122-005-0032-1 PMid:16172895
Smith A.M., Denyer K., and Martin C., 1997, The synthesis of the starch
granule, Annu Rev Plant Physiol Plant Mol Biol., 48: 67-87 doi:10.1146/
annurev.arplant.48.1.67 PMid:15012257
Song R., and Messing J., 2003, Gene expression of a gene family in maize
based on noncollinear haplotypes, Proc Natl Acad Sci USA, 100(15):
9055-9060 doi:10.1073/pnas.1032999100 PMid:12853580 PMCid:166437
Vrinten P.L., and Nakamura T., 2000, Wheat granule-bound starch synthase I
and II are encoded by separate genes that are expressed in different tissues,
Plant Physiol., 122(1): 255-264 doi:10.1104/pp.122.1.255 PMid:10631269
Wendel J.F., 2000, Genome evolution in polyploids, Plant Mol Biol., 42(1):
225-249 doi:10.1023/A:1006392424384 PMid:10688139
Yan H.B., Jiang H.W., Pan X.X., Li M.R., Chen Y.P., and Wu G.J., 2009, The
gene encoding starch synthase IIc exists in maize and wheat, Plant Science,
176(1): 51-57 doi:10.1016/j.plantsci.2008.09.003
Yan H.B., Pan X.X., Jiang H.W., and Wu G.J., 2009, Comparison of the starch
synthesis genes between maize and rice: Copies, chromosome location and
expression divergence, Theor. Appl. Genet., 119(5): 815-825 doi:10.1007/
s00122-009-1091-5 PMid:19593540