Basic HTML Version
Molecular Plant Breeding 2011, Vol.2, No.16, 109
-
118
http://mpb.sophiapublisher.com
117
the intron sequences are quite differences existing in
three lily species that might affect the expression of
SCA, thereby leading to affect the recognizing
capabilities of pollen tube to SCA in different species.
Different copies of the SCA from the same species
have differences in the introns, which might lead to be
differential expressions of different copies of SCA in
different tissues, accordingly resulting in different
functions of different SCA copies of the same species,
of which needs to be considered in the follow-up
studies.
Our study also found that SCA has diversity existing
in lily genome, which is consistent with the previous
genetic findings of LTP gene in other species, such as
Arabidopsis (Arondel et al., 2000; Soufleri et al., 1996;
Chae et al., 2010). LTPs are considered as a kind of
defense proteins as well as a class of sulfur protein-like
stress-resistant peptides (Broekaert et al., 1997). Although
stress resistance might be the dominant functions,
these proteins might be recently considered to have
additional function, that is, as the factor of chemotropism
in signal transduction (Yang et al., 1999). Lily SCA
has genetic diversity, it might belong to a multi-functional
gene, nevertheless, this requires further biological
validation.
3 Materials and Methods
3.1 for the test material
The bulbs of Asian lily 'Tresor' (
Lilium
Asiatic
Hybrids), Easter lily 'White heaven' (
Lilium Longiflorum
Hybrids) and Oriental lily 'Caruso' (
Lilium
Oriental
Hybrids) were purchased at the Beijing Shenzhou
Kelaowo Horticultural Technology Co., Ltd., planted
in the flower room at the tissue culture center of
Beijing Agricultural College. Fresh young leaves
without any harm of pests and diseases were collected
into sealed plastic bag and stored in ultra-low
temperature refrigerator at
-
80
℃
ready for use.
2×
Taq
PCR Green Mix were purchased from Beijing
Dingguo Changshun Biotechnology Co., Ltd. DNA
markers, gel extraction kit and E. coli competent cells
Top 10 were purchased from the Tiangen Company; T
vector is the product of Takabo Bio-Engineering
Co., Ltd.
3.2 Genomic DNA extraction
Genomic DNA was extracted following with the
CTAB method (Lin, 2004).
3.3 Primer design and PCR amplification
The primers were designed according to non-coding
region of the SCA cDNA of
Lilium longiflorum
'Nellie
white' from GenBank in NCBI, one of primer was
LSCAF: 5'
-
ACTCCCATTCTTACCAGCTCTCCTT
-
3'
and another was LSCAR: 5'
-
CTGAAACAGAAGAC
TACAACACCGC
-
3' both synthesized by the Shanghai
Yingjun Company.
In total of 25 μL volume of PCR reaction containing
2×
Taq
PCR Green Mix 12.5 μL, primers (10 μM) of
0.5 μL each, DNA template (35 ng/μL) 5 μL, adding
ddH
2
O 6 μL up to 25 μL. PCR procedures were as
following: 94
℃
pre-denaturation for 5min and then
38 cycles of 94
℃
denaturing for 40 s, 55
℃
annealing
for 30 s, 72
℃
extension for 40 s, finally 72
℃
extension for 10 min and placed at 4
℃
for store. PCR
products were scored by 2.0% agarose gel electrophoresis
and photographed by gel imaging system camera.
3.4 Amplified fragment of SCA cloning, sequencing
and aligning
PCR products were recovered from agarose gel and
ligated to the pMD19-T vector and then transferred
into competent
Escherichia coli
TOP 10 for cloning.
Positive clones were picked by Blue-white screening
method to be identified by inoculated medium PCR.
The insert fragments of amplified products were
determined by gel electrophoresis to be sequenced
by Shanghai Yingjun Biotechnology Co., Ltd. for
sequencing.
3.5 Sequence analysis
Similarity comparison of the cloned sequences was
carried out by using DNAMAN software. The largest
open reading frame was determined and the amino
acid sequence was deduced by using DNAStar software.
The possible existing signal peptide was predicted
based on SignalP (http://www.cbs.dtu.dk/services/SignalP/)
and the homologous sequences were searched online
by using the NCBI BLAST program. The multiple
comparisons of the sequences were conducted by
using Clustal X and Mega4 as well as phylogenetic