Page 8 - Legume Genomics and Genetics

Legume Genomics and Genetics (online), 2010, Vol. 1, No.3, 11-17
http://lgg.sophiapublisher.com
15
DNA. The first-strand cDNA was synthesized with
RT-PCR kit (Promega, Wisconsin, USA) using 500 ng
of total RNA according to the manufacturer’s instruct-
tions. Controls received water instead of reverse trans-
criptase to assess any contamination from genomic
DNA as described by Zhou et al. (2007).
3.3 Full-length cDNA sequence isolation
PCR was performed with the LA PCR system (Takara)
l2, 1 μL of
educed by BioXM 2.6. Phy-
aligned using ClustalX
SⅠ-R) were
erformed by using a
Table 1 Primers used in experiment
Name Oligonucleotide sequence (5’–3’)
using 2.5 μL of 10×PCR buffer with MgC
10 μmol/L each primer, 4.0 μL of 10 mmol/L dNTPs,
1 μL cDNA samples and 0.5 μL LA Taq ™ DNA poly-
merase, and 15 μL double distilled water. Reaction con-
ditions were as follows: 5 min denaturation at 94℃,
followed by 30 cycles of 94℃ for 30 s, 55℃ for 30 s
and 72℃ for 1 min 30 s, finally extended at 72 ℃ for
10 min. The PCR products were run on 1% agarose
gel and purified with Gel Extraction Kit (TaKaRa)
according to the manufacturer’s protocol. The purified
products were then cloned into the pMD18-T Easy
vector (TaKaRa) and sequenced (Shangon, Shanghai).
3.4 Sequence analysis
Open reading frame (ORF) and encoded amino acid
sequence of genes were d
sicochemical properties of the deduced protein were
predicted by Protparam (http://www.expasy.ch/tools/
protparam.html). The putative subcellular localiza-
tions of the candidate proteins were estimated by Tar-
getP (http://www.cbs.dtu.dk/services/TargetP/) and
Predotar (http://urgi.versailles.inra.fr/predotar/predotar.
html). The potential N-terminal presequence cleavage
site was predicted by ChloroP (http://www.cbs.dtu.dk/
services/ChloroP/).
3.5 Phylogenetic analysis
Amino acid sequences were
program with the implanted BioEdit (Thompson et al.,
1994). The neighbor-joining (NJ) method in MEGA4
(Tamura et al., 2007) was used to construct the phylo-
genetic tree. Bootstrap with 1 000 replicates was used
to establish the confidence limit of the tree branches.
Default program parameters were used.
3.6 Expression of AhKASⅠ in E. coli
Two specific primers (KASⅠ-F2 and KA
used to obtain the full-length open reading frames
(Table 1). The 5’ end of the KASⅠ -F2 and KASⅠ -
R2 contains an EcoRⅠ or an XhoⅠ restriction site
(underlined) to facilitate subsequent manipulations.
The amplified fragment was digested with EcoRⅠ
and XhoⅠ, followed by ligation with EcoRⅠ /XhoⅠ-
digested pET-28a (Novagen) to produce pET-KASⅠ ,
and no amplification errors were detected through re-
sequencing. The constructed plasmid was transformed
into E. coli strain BL21 and grown in 50 mL LB me-
dium containing 50 ug/ml kanamycin at 37℃ to a
optical density of A600=0.6~0.8. The expression of re-
combinant protein was induced by adding isopropyl
β-D-thiogalactoside (IPTG) to the culture at a final con-
centration of 1.0 mmol/L. Cells were harvested by cen-
trifugation after incubation at 37 ℃ for 1 h, 2 h, 4 h, 6 h,
8 h, respectively. The protein extracts were analyzed
by SDS-polyacrylamide gel electrophoresis (PAGE)
and stained with Coomassie brilliant blue R-250.
3.7 Quantitative real-time PCR
The real-time PCR analysis was p
LightCycler 2.0 instrument system (Roche, Germany).
β-actin gene was taken as reference gene. Three pairs
of gene-specific primers (Table 1) were designed ac-
Type
KASⅠ-F1 ATGCAAGCCATTCACACACC Full-length cDNA sequence cloning
A
Real-time PCR
GC
KASⅠ-R1 TCAGGGCTTGAAAGCAGAAA
qActin-F TTGGAATGGGTCAGAAGGATGC
qActin-R AGTGGTGCCTCAGTAAGAAGC
qKASⅠ-F TCTACTCTTGCTGGTGACTTGG
qKASⅠ-R ATTGAATTGATTGATTGACGGAT
KASⅠ-F2 TTGGAATTCATGCAAGCCATTCACAC Prokaryotic expression
KASⅠ-R2 TACCTCGAGTCAGGGCTTGAAAGCAG