Page 6 - BM 2010 Vol.1 No.1

Bioscience Methods
BM 2010, Vol.1, No.1 http://bm.sophiapublisher.com
- 3 -
Table 1 Markers with polymorphisms detected among ‘9145 family’: between two pairs of bulks made with the extreme resistant
(R) and susceptible (S) individuals genomic DNA and their parents Swingle citrumelo and LB6- 2
Marker Primer Sequence Tm (℃) Digestion enzyme Polymorphism
7A4R 5'-upper (F) GGCATCTCTATGAACTCTACAG 50 AluⅠ Codominant
3' -lower (R) AATAGAGGACAAGTCGATATG
7A4L 5'-upper (F) TTTGGAACTTATCAACTACA 56 - Codominant, P/A
3' -lower (R) AGATGAGTTCTCCTTTTATAGTTA
7A4(1407) 5'-upper (F) GTTGGAAAGACGACTCTGTTA 53 BfaⅠ Codominant
3' -lower (R) CAAACAGAACATTACTTTTCAATC
7A4(2168) 5'-upper (F) CAATGTTTGATAAAGTATGGAGA 50 BfaⅠ Codominant
3' -lower (R) TCTTCTCCCTTGATAACGACTTTAC
40b15L 5' -upper (F) AAGTGTAGCTGTAGTATGATACC 48 - Codominant, P/A
3' -lower (R) TTAGATAATGGATTTCATAACT
45b9T 5' -upper (F) GGATCCTTGTAGTAATTTGTTGT 55 Hinf Ⅰ Codominant
3' -lower (R) GGAAGGCGGAAATTTACTGTT
4L17R 5' -upper (F) GATGTAGGGGTCTTTATGTAA 58 Cfo Ⅰ Codominant
3' -lower (R) GTCGCTTTGCATGTTGTA
4L17L 5' -upper (F) TAGAAACCCCAATTCAAAAG 58 HindⅢ Codominant
3' -lower (R) GACTTGAGAAGCAGAGAATGTC
3p21S 5'-upper (F) TCGAAGACTTGCAAGATTGTT 55 Msp Ⅰ Codominant
3' -lower (R) CAATTTCCCAACTTGGTTGT
Y65F+R 5'-upper (F) GCATCCCTCTTCCTAATTCACA 50 RsaⅠ Codominant
3' -lower (R) TCTGCCAAGCCTGAAACATC
Note: P/A: Presence or absence of DNA bands
The anchoring markers order of the first round
linkage group (Figure 2C) in ‘9145 family’ was not
different from the one (Figure 2B) generated by
MAPMAKER EXP3.0b (Deng et al., 2000) and the
one (Figure 2A) in R family. The second round map
(Figure 3A) construction with the more specific
markers included showed almost the same markers
order and genetic distance with the first round built
map (Figure 2C) except that the locus of 7A4L was
different. After incorporation of the specific marker
7A4(1407) and 7A4(2167), 7A4L locus had
changed its position from the top of the Pt8 to the
lower of Pt8 on the map, far away from the
presumed CN resistance “Tyr1” locus (between Pt8
and SCO07). In this linkage map, nine
GRC-derived markers' loci spanned 12.1 cM of
between the “Tyr1” and the “Ctv” regions (SCAR
marker SCAD08 were supposed to be the Ctv locus).
7A4R was the closest marker locus to “Tyr1” at
distance of 1.5 cM, 7A4(1407), 7A4(2168), 4L17L
and 40b15 flanked “Tyr1” at distance of 2.1 cM.
225 individuals were randomly chosen from ‘9401
family’ to screen their genotype segregation with
the eight markers that were located between Ctv and
Tyr1 regions in ‘9145 family’ linkage map. The map
constructed with the data of 225 individuals' marker
segregation showed in Figure 3B. Eight markers
were successfully mapped into one linkage group
and the map covered 87.5 cM, with average map
density of 11 cM per marker. Compared with CN
resistance map (Figure 3A), the orders of three
common markers 4L17R, 4L17L and SCO07 were
completely altered in the linkage map of ‘9401
family’. But the order of another five markers
basically stayed in the same.
The two markers 4L17R and 4L17L that were from
the two borders of BAC clone insert (about the
length of 80 kb) is just 3 cM apart in genetic map of
‘9145’ population, far less than the genetic distance
of the two ends of 7A4 (6.6~7.1 cM), but is 87.5
cM apart in genetic map of ‘9401’ population. To
the best of our knowledge, marker SCAD08 is very
close to the Ctv locus and marker SCO07 is
co-segregated with Tyr1 locus. From the linkage