Page 9 - gabVol3No1

Basic HTML Version

Genomics and Applied Biology
,
2012, Vol.3 No.3, 1
-
7
http://gab.sophiapublisher.com
- 6 -
library were recognized when color was observed with
the probe R121A, but not with probe R121B or a
deeper color was observed with probe R121A than
with probe R121B. The positive clones on the membrane
of reverse subtractive library were recognized when
color was observed with probe R121B, but not with
probe R121A, or the color with probe R121B was
deeper than with probe R121A. The positive clones
were sequenced by the Invitrogen Co, Shanghai.
3.8 Homology and function analyses of the sequences
The data of sequences from the section 3.7 were put
into the software DNAMAN, and the vector and linker
sequences were removed. The cDNA sequences that
we obtained were submitted to the NCBI database
(http://blast.ncbi.nlm.nih.gov/Blast.cgi ) for an online
homology comparison. The functions of the genes
were predicted based on the reference annotation they
well matched and on literature.
The software Primer 5 was used to design the primers
for the quantitative expression analyses based on the
above results.
3.9 Fluorescent quantitative expression analysis of
the functional gene
3.9.1 Synthesis of the first strand of cDNA
The total RNA from the male sterile buds (A1, A2, A3,
A4, A5, A6, A7) and the male fertile buds (B1, B2,
B3, B4, B5, B6, B7) in the section 3.4 were reversely
transcribed into the first strands of cDNA according to
the specification of the PrimeScript RT reagent Kit.
(Perfect Real Time, Cat. No. DRR037S).
3.9.2 Selection of reference gene and detection of
amplification efficiency
The reversely transcribed cDNA from different lengths
of buds was used as template. Primers were from the
generally used internal reference gene actin (F: TCC
TCACGCTATCGCTATCCTCCG; R: GATGTTTCC
ATACAGATCCTTCC) and two reported internal
reference gene, tip41 (F: AGAGTCATGCCAAGTTCA
TGGTT; R: CCTCATAAGCACACCATCAACTCT
AA), and ubc21 (F: CCTCTGCAGCCTCCTCAAGT;
R: CATA TCTCCCCTGTCTTGAAATCG) in literature
(Chen et al., 2010), respectively. The least variable
and stably expressed internal reference gene was
screened out following the operation manual of the
SYBR Premix Ex
Taq
Ⅱ
Perfect Real Time (Cat. No.
DRR081S) by TaKaRa.
In order to determine the amplification efficiency and
specificity of the reference gene, the plasmid containing
the reference gene was diluted by multiples of 10 into
a series of gradient dilution to the concentration of 10
-8
.
Each gradient plasmid dilution was used as template to
conduct Real-Time quantitative PCR, sequentially, in
a 15 uL volume system on the PCR instrument BIO-
RAD CFX96. Dissolution curve and standard curve of
the reference gene were obtained using the CFX manager
software provided with the BIO-RAD CFX96 instrument.
3.9.3 Extraction of plasmid DNA and test of the
primer amplification efficiency
The bacterium clone with the target gene fragment was
further multiplied. Plasmid of this clone was extracted
according to the plasmid Miniprep Kit (Cat. No. DP
10302). Then a set of gradient dilution of the plasmid
were prepared in multiples of 10 to the concentration
of 10
-8
. The gradient plasmid dilutions were used as
template sequentially. The primers for the target gene
were designed with the software Primer 5. Real-time
fluorescent quantitative PCR was performed in a 15 uL
volume system on the instrument BIO-RAD CFX96
PCR. The primer amplification efficiency and specificity
were analyzed and the dissolution curve and standard
curve of the target gene were obtained using the
CFX manager software provided with the BIO-RAD
CFX96 instrument.
3.9.4 The expression of
MF6
gene in the buds with
different fertility and length
The first strand of cDNA transcribed from the total
RNA of the 7 grades of male fertile and male sterile buds
was used as templates. The primers were those previously
screened for the internal reference genes and the target
gene. The reaction system and the PCR procedure
were the same as used in the establishment of the
standard curve. The CFX manager software with the
PCR instrument BIO-RAD CFX96 was used to analyze
the expression of the target gene
MF6
when the reaction
was completed.
Authors’ Contribution
RXH participated the experimental design, conducted the experiment
operation, data analysis and paper writing. ZKT and SXG
participated in the experimental design, provided the plant
materials, and gave experiment instruction. YZN, the responsible
author, provided the project idea, directed the experimental design,
operation and data analyses. All authors have read and approved
the final manuscript.