Page 9 - Triticeae Genomics and Genetics

Basic HTML Version

Triticeae Genomics and Genetics 2012, Vol.3, No.1, 1
-
6
http://tgg.sophiapublisher.com
6
experiment, Qian et al (2011) argued a view that
amphipathic α-helices of DHN6 might perform a
physical and stable protection of peripheral membrane
in plant cells subjected to water deficit and temperature
changes. Here, the authors described that amphipathic
α-helices formed by the conserved motifs of N-, C-, and
K-sequence could be associated with peripheral
membrane protections in the water-deficit cell.
Generally, mtRNA and rRNA of the eukaryotic cells
were applied to analyze the phylogenetic characters in
the most of studies (Jia et al., 2007; Emre et al., 2007;
Marschner et al., 2007). However, inaccurate conclusions
could be obtained from the experimental materials
because of their highly variable eco-geographic
origins. Sun et al (2008), supporting our views, also
agreed with an argument that functional genes could
be served as phylogenetic relationships in the sampled
eco-geographic plants.
In our tests, the same scaffold of barley was accurately
observed in the gramineae crops, as compared with
the far genetic distance in the woody plants such as
Prunus persica
,
Pinus sylvestris
and
Picea abies
(Figure 5). As described above, earlier genetic
separation took place in barleys while the other
scaffolds performed their respective evolutions
involving
Triticum turgidum
ssp.
Durum, Zea mays
and Oryza sativa
. The results of phylogenetic
relationships indicated that
Dhn
6 gene could be an
efficient foundation for identifying and distinguishing
of different species associated with those special
amino acid sequences (Figure 5). Moreover, phylogenetic
tree may elucidate not only the molecular evolutionary
relationships among diverse species, but the functional
roles based on amino acid sequences of the deduced
proteins (Khuri et al., 2001; Xiong et al., 2011). The
last step in the dehydration-signaling cascade was the
alternation of genes responsible for the synthesis of
compounds that serve to protect cellular structures
against the deleterious effects of dehydration, such as
proteins with protective functions encoded for by the
late embryogenesis abundant
(LEA) genes (Bartels
and Souer, 2004; Hazen et al., 2005). Therefore, it was
concluded that
Dhn
6 gene could be used as a
reference for identification of species, associated
with the important protective roles and phylogenetic
tree of DHN6.
3 Materials and Methods
3.1 Plant materials
The experimental materials, harvested from Yun-Gui
plateau, were selected to compare with their
molecular traits, secondary structure and phylogeny
of DHN6, including six-rowed barley (BZ-12),
four-rowed line (BZ-16) and two-rowed one (BZ-26)
in the present study.
3.2 Extraction of genomic DNA and cloning of
Dhn6
gene
Total genomic DNA was extracted from 7-day-old
fresh seedlings following a modified cetyltrimethyl
ammonium bromide (CTAB) protocol, as described
by Saghai-Maroof et al (1984). PCR reactions were
performed in a volume of 20 µL containing 50 ng
genomic DNA, 1 × PCR buffer, 200 µM dNTPs, 10 mM
of primers (P
1
: 5'
-
CGGCATCCGCTTGACATT
-
3',
and P
2
: 5'
-
GCAAGTCAGGCTCAGTTCAGT
-
3') and
0.5 U of
Taq
polymerase (TOYOBO Co., LTD., China).
PCR reaction was started at denaturation step of 10
min, followed by 35 cycles at 95
℃
for 60 s, 55
℃
for
60 s, 72
℃
for 60 s, and terminated at 72
℃
for 8 min.
PCR products were separated on 1.2% agarose gels
and purified with DNA gel extraction Kit. The
purified PCR products were cloned into plasmid
vector pMD18
-
T (TaKaRa Biotechnology Co., Ltd.)
and followed sequenced for each genotype in triplicate.
3.3 Prediction and analysis of protein structural
domain
Sequence similarity analysis in GenBank was performed
using the Blast 2.1 search tool (http://www.ncbi.nlm.nih.
gov/blast/). Nucleotides and amino acid sequence
analyses were performed with DNAMAN programme.
To predict the biophysics characteristics of the
putative protein of DHN6, software on the ExPASy
Proteomics Server (http://au.expasy.org/) was used.
The prediction and analysis for the protein structural
domain and functional site were performed using
Prosite software (http://www.expasy.org/prosite/), involving
molecular weight, theoretical isoelectric point (pI) and
character of amino acid sequences. Phylogenetic and
molecular evolutionary analyses were conducted using
MEGA 3.1 software (Kumar et al., 2004). ClustalW