Basic HTML Version
Deng et al., 2011, Ectopic expression of an
AGAMOUS
homolog
NTAG1
from
Chinese narcissus accelerated earlier flowering and senescence in Arabidopsis, Molecular Plant Breeding Vol.2 No.3 (doi: 10.5376/mpb.2011.02.0003)
20
3.7 Semi-quantitative reverse transcription-polym-
erase chain reaction (RT-PCR)
Five microgram of total RNA extracted from different
plant tissues was used for generating the first strand of
cDNA according to the instructions of the Superscript
RT (Toyobo, Japan). PCR amplification was performed
with gene specific primers. For
SAG12
gene, specific
forward (5'
-
CCAATGACGAATTTCGTTCC
-
3') and
reverse (5'
-
TGTCGCAATCAACAAGCTGT
-
3') primers
were used. For
NTAG1
gene, specific AGAMOUS F and
AGAMOUS R primers were used. Expression levels of
ACTIN
were monitored to serve as a quantifying control.
Authors’ contributions
DXJ and XLJ carried out the gene cloning and transgenic
planting phenotype analysis, and WY helped with the
phenotype analysis and took part in the data analysis. SY took
part in the technique instruction. LXF performed the
experiment designs and drafted the manuscript. All authors
read and approved the final manuscript.
Acknowledgements
This work was supposed by Shanghai Natural Science Program
on Key Basic Research Project (09JC1405100) and the
National Natural Science Foundation of China (30771155)
．
References
Bowman J.L., Smyth D.R., and Meyerowitz E.M., 1989, Genes directing
flower development in Arabidopsis, Plant Cell, 1(1): 37-52
Causier B., Castillo R., Zhou J., Ingram R., Xue Y., Schwarz-Sommer Z.,
and Davies B., 2005, Evolution in action: following function in
duplicated floral homeotic genes, Curr Biol., 15(16): 1508-1512
Coen E.S., and Meyerowitz E.M., 1991, The war of the whorls: genetic
interactions controlling flower development, Nature, 353(6339): 31-37
Colombo L., Franken J., Koetje E., van Went J., Dons H.J., Angenent G.C.,
and van Tunen A.J., 1995, The petunia MADS box gene FBP11
determines ovule identity, Plant Cell, 7(11): 1859-1868
Colombo L., Franken J., Van der Krol A.R., Wittich P.E., Dons H.J., and
Angenent G.C., 1997, Downregulation of ovule-specific MADS box
genes from petunia results in maternally controlled defects in seed
development, Plant Cell, 9(5): 703-715
Davies B., Motte P., Keck E., Saedler H., Sommer H., and Schwarz-Sommer
Z., 1999, PLENA and FARINELLI: Redundancy and regulatory
interactions between two Antirrhinum MADS-box factors controlling
flower development, Embo J., 18(14): 4023-4034
Drews G.N., Bowman J.L., and Meyerowitz E.M., 1991, Negative
regulation of the Arabidopsis homeotic gene AGAMOUS by the
APETALA2 product, Cell, 65(6): 991-1002
Dubois A., Raymond O., Maene M., Baudino S., Langlade N.B., Boltz V.,
Vergne P., and Bendahmane M., 2010, Tinkering with the C-function: a
molecular frame for the selection of double flowers in cultivated roses,
PLoS One, 5(2): e9288
Ferrario S., Shchennikova A.V., Franken J., Immink R.G., and Angenent
G.C., 2006, Control of floral meristem determinacy in petunia by
MADS-box transcription factors, Plant Physiol, 140 (3): 890-898
Gan S., and Amasino R., 1995, Inhibition of leaf senescence by
autoregulated production of cytokinin, Science, 270: 1986-1988
Gao Z.M., Chen D.F., Li X.P., Cai C.J., and Peng Z.H., 2008, Cloning and
sequence analysis of a flowering-related M ADS-box gene in narcissus
tazetta var. chinensis roem, Acta. Horticuhurae Sinica, 35(2): 295-230
Jofuku K.D., den Boer B.G., Van Montagu M., and Okamuro J.K., 1994,
Control of arabidopsis flower and seed development by the homeotic
gene APETALA2, Plant Cell, 6(9): 1211-1225
Koncz C., and Schell J., 1986, The promoter of TL-DNA gene 5 controls the
tissue-specific expression of chimaeric genes carried by a novel
agrobacterium binary vector, Mol. Gen. Genet, 204: 383-396
Lohmann J.U., and Weigel D., 2002, Building beauty: the genetic control of
floral patterning, Dev. Cell, 2(2): 135-142
Mandel M.A., Bowman J.L., Kempin S.A., Ma H., Meyerowitz E.M., and
Yanofsky M.F., 1992, Manipulation of flower structure in transgenic
tobacco, Cell, 71(1): 133-143
Melzer R., Verelst W., and Theissen G., 2009, The class E floral homeotic
protein SEPALLATA3 is sufficient to loop DNA in 'floral quartet'-like
complexes in vitro, Nucleic Acids Res., 37(1): 144-157
Mizukami Y., and Ma H., 1992, Ectopic expression of the floral homeotic
gene AGAMOUS in transgenic arabidopsis plants alters floral organ
identity, Cell, 71(1): 119-131
Mizukami Y., and Ma H., 1997, Determination of arabidopsis floral
meristem identity by AGAMOUS, Plant Cell, 9(3): 393-408
Murashige T., and Skoog F., 1962, A revised medium for rapid growth and
bioassays with tobacco tissue cultures, Physiol Plant 15: 473-479
Parcy F., Nilsson O., Busch M.A., Lee I., and Weigel D., 1998, A genetic
framework for floral patterning, Nature, 395(6702): 561-566
Pelaz S., Ditta G.S., Baumann E., Wisman E., and Yanofsky M.F., 2000, B
and C floral organ identity functions require SEPALLATA MADS-box
genes, Nature, 405(6783): 200-203
Pelaz S., Tapia-Lopez R., Alvarez-Buylla E.R., and Yanofsky M.F., 2001,
Conversion of leaves into petals in arabidopsis, Curr Biol., 11(3):
182-184
Roeder A.H., and Yanofsky M.F., 2001, Unraveling the mystery of double
flowers, Dev. Cell, 1(1): 4-6
Rounsley S.D., Ditta G.S., and Yanofsky M.F., 1995, Diverse roles for
MADS box genes in arabidopsis development, Plant Cell, 7(8):
1259-1269
Rutledge R., Regan S., Nicolas O., Fobert P., Cote C., Bosnich W., Kauffeldt
C., Sunohara G., Seguin A., and Stewart D., 1998, Characterization of
an AGAMOUS homologue from the conifer black spruce (Picea
mariana) that produces floral homeotic conversions when expressed in
arabidopsis, Plant J., 15(5): 625-634
Saedler H., Becker A., Winter K.U., Kirchner C., and Theissen G., 2001,
MADS-box genes are involved in floral development and evolution,
Acta Biochim Pol., 48(2): 351-358
Theissen G., 2001, Development of floral organ identity: stories from the
MADS house, Curr Opin Plant Biol., 4(1): 75-85
Tzeng T.Y., Chen H.Y., and Yang C.H., 2002, Ectopic expression of
carpel-specific MADS box genes from lily and lisianthus causes
similar homeotic conversion of sepal and petal in Arabidopsis, Plant
Physiol, 130(4): 1827-1836
Wang Z.K., Gao J., Li L.B., and Peng Z.H., 2006, Isolation and
characterization of the AGAMOUS homologous gene NTAG in
Chinese narcissus (Narcissus tazetta var. chinensis Roem), For Stud
China, 8(1): 21-26
Weigel D., Alvarez J., Smyth D.R., Yanofsky M.F., and Meyerowitz E.M.,
1992, LEAFY controls floral meristem identity in arabidopsis, Cell,