Basic HTML Version
Genomics and Applied Biology, 2011, Vol.2 No.2
http://gab.sophiapublisher.com
- 16 -
2.4 Detection of
P19
gene in the three tomato cultivars
inoculated with TBSV cDNA synthesis
cDNA of the three inoculated tomato cultivars and
their control samples was synthesized using the
forward primers of P19 (Table 1), 2 μL of extracted
RNA from infected plant, 2 μL (25 mmol/L) dNTPs
(Sib Enzyme, Russia), 0.2 μL (20 U/ μL) of RT-
enzyme, the volume was completed by sterile distilled
up to 20 μL. The mixture was incubated at 42
℃
for
60 min, then at 70
℃
for 10 min, then hold at 4
℃
in a
thermocycler (Gene Amp 9700, Applied Biosystems
ABI, USA) (Sambrook & Russell 2001).
Table 1 Primers used in this study
Primer name
Sequence 5’ to 3’
CHR
TGCCTTTGATTCAGTCATC
F3H F
AGAGAGGGGAAATATGTAGG
P19 F
AGCTCGAGCCATGGAACGAGCTAT
P19 R
AGCTGCAGTTACTCGCTTTCTTTTTCG
2.5 PCR for amplification of
P19
gene
PCR reaction was performed in a total volume of 25 μL
containing 2.5 μL (10
×
)
Taq
buffer 1.5 μL 25 mmol/L
MgCl
2
, 1 μL dNTP mixture, 0.25 μL
Taq
polymerase
(Red Hot
Taq
DNA Polymerase, Thermo fisher scientific
(Abgene), USA), 2 μL from each P19 primer (Table 1),
2 μL cDNA and sterile distilled H
2
O up to 25 μL. The
reaction mixture was subjected to amplification as
follows: activation for the enzyme 94 for 3 min,
℃
followed by 35 cycles of amplification with denaturation
for the DNA at 94 for 20 sec, annealing at 67 for
℃
℃
30 sec, and extension at 72 for 1 min and final
℃
extension cycle at 72 for 5 min. Finally, the reaction
℃
stored at 4 . PCR products were checked by electro
℃
-
phoresis 1.5% agarose.
2.6 Differential display for detection of up-down regulated
plant defense gene using flavonoid gene primer as
arbitrary primers
We used the flavnoid primers as arbitrary because of
falvnoid is one of the defensin genes produced against
most plant pathogen. Total RNA extract was subjected
to cDNA synthesis using one oligo (dT) primer as
previously described. The amplified cDNA was used
as a template for differential display reaction. The
PCR reaction was performed by combining the following;
a 25 μL reaction mixture containing; 2.5 µL 10×
Taq
DNA polymerase buffer, 2.5 µL 50 mmol /L MgCl
2
,
2 µL from each primer (40 pmol/µL) (Table 1), and
0.25 µL of
Taq
polymerase (AmpliTaq, Perkin- Elmer,
5 U/µL), 2.5 µL from the cDNA, 2.5 µL dNTPase
4 mmol /L and 12.75 µL of dH
2
O. The PCR reaction
was performed in 9700 thermal cycler (Perkin-Elmer)
and the PCR conditions was performed as following:
initial denaturation 95
℃
for 5 min, followed by 40
cycles (94
℃
for 1 min; 53
℃
for 1 min; and 72
℃
for 2 min) and finally extension, 72
℃
for 10 min. The
reaction was stored at 4
℃
until used. PCR product
was separated on 1.5% agarose gel.
2.7 Cloning of the up regulated DNA bands
The resultant PCR product was excised from the gel
and purified using a QIA quick gel extraction kit
(Qiagen Inc., Germany). Purified DNAs were ligated
into the pGEM-T vector (Promega Co., USA).
Recombinant DNA plasmids was then sequenced
using an automated sequencer (Macrogene Company,
Korea), with forward universal primer. DNA homology
searches were carried out with the NCB1 data bases,
using the BLAST (Altschut et al., 1990).
2.8 Nucleotide sequence and sequence analysis
Analysis of nucleotide and deduced amino acid
sequences was carried out using EditSeq-DNAstar
Inc., Expert Sequence Analysis software, Windows 32
Edit Seq 4.00 (1989~1999) and ExPasy database on
the internet. Blast search for alignment of the obtained
sequence with the published ones was done using
database of National Centre for Biotechnology
Information (NCBI). DNA nucleotide sequence was
submitted into EST GenBank under the accession
numbers HO054970, HO054971 and HO054972.
2.9 Phylogenetic analysis
Phylogentic analysis was carried out using MEGA4
program Tamura et al (2007).
Author Contributions
Elsayed E Hafez conceived and conducted this research and
prepared the manuscript.Mahmoud F.M. Moustafa involved
this research and collected data. Both on them had read the
final version of this paper and agreed with the authors’ credits.
Acknowledgements
We would like to thank professors Hanu Pappu and Pervaiz
Abbasi for their kind help and guidance in the preparation of