Page 11 - Genomics and Applied Biology

Basic HTML Version

Genomics and Applied Biology, 2011, Vol.2 No.1
http://gab.sophiapublisher.com
- 8 -
Lolium perenne
L. EF495352,
Zea mays
BT016732 at
amino acid level by DNAStar software. On the other
hand, we assayed the protein transmembrane structure
of Put Px on line (http://www.cbs.dtu.dk/cgi-bin/nph)
by ProtParam soft. At last, the subcellular localization
of
PutAPx
gene was analysed and predicted
respectively by PSORT and ProtComp Version 611
softwares (http://www.softberry.Compberry.phtml).
3.6 Congstruction of yeast expression vector
pYES2-PutAPx and its antioxidation analysis
transforming into yeast
PCR the recombination plasmid pT-PutA Px and add
two restriction enzyme sites of
Bam
H
Ⅰ
and
Xba
Ⅰ
to
ORF of pT-PutA Px, and then isolate and recover
pYES2 vector and target fragment after digesting by
Bam
H
Ⅰ
and
Xba
Ⅰ
, then linke the two fragments by
T4 ligase to transforme into
Escherichia coli
JM109.
After identifing by the above enzymes, we assigned
the recombination plasmid as pYES2
-
PutAPx.
the pYES2
-
PutAPx was tranformed into yeast strain
INVScI by lithium acetate (Goetz et al., 1995), and
the clones were detected by PCR (F2: 5'
-
GGATCCAT
GGCGGCCCCGGT
-
3'; R2: 5'
-
TCTAGATTACTTGC
TCCTCTTG
-
3'). The positive clones were cultivated
on the SD medium. Diluted the yeast transformants
pYES2
-
PutAPx and pYES2 into 100 different
concentration, and cultivated on the SD medium with
0 mmol/L, 2 mmol/L, 4 mmol/L, 8 mmol/L, 16 mmol/L
H
2
O
2
respectively. the OD
600
was 2 and the yeast
solution was dilute 10
-1
, 10
-2
, 10
-3
, 10
-4
respectively,
and were cultivated at 30
℃
to observe the growth
status directly. Finally, comparing the adaptive
capability of recombination transformed yeasts under
oxidative stress.
3.7 Tissue specific expression analysis of
PutA Px
The tested mateials about leaves, roots, stems, sheaths,
anthers, female flowers, scapes, pollinated ears of
Puccinellia tenuiflora
were collected at flowering
phase and total RNA of them were extracted
respectively using TRizol. And then cDNA were
obtained by reverse transcription kit. PCR cDNA by
two specific primers (F3: 5'
-
CGATGGCGGCCCCG
GTGGTG
-
3', R3: 5'
-
CCTTACTTGCTCCTCTTGGA
-
3',
annealed at 56
℃
, 30 cycles) to analyse the Tissue
specific expression of
PutA Px
in different tissues via
detecting with 0.8% agarose gel electrophoresis.
Author Contributions
Qingjie Guan and Shenkui Liu conceived and conducted this
research and prepared the manuscript. Qingjie Guan, Lin Li and
Takano Tetsuo involved this research and collected data. All of
them had read the final version of this paper and agreed with
the authors’ credits.
Acknowledgements
This work was initiated by the Youth Science Fund of
Northeast Forestry University (07049) and Harbin Youth
Science and Technology Innovation Fund Project
(RC2007QN002079). We also thank two anonymous reviewers
for their strict criticism on this paper.
References
Asada K., 1992, Ascorbate peroxidase: a hydrogen peroxide scavenging
enzyme in plants, Physiologia. Plantarum., 85(2): 235-241 doi:
10.1111/j.1399-3054.1992.tb04728.x doi:10.1034/j.1399-3054.1992.
850216.x
Goetz R.D., Schiestl R.H., Willems A.R., and Woods R.A., 1995, Studies
on the transformation of intact yeast cells by the Li-Ac/SS-DNA/ PEG
procedure, Yeast, 11(4): 355-360 doi: 10.1002/yea.320110408 PMid:
7785336
Ishikawa T., Sakai K., Takeda T., and Shigeoka S., 1995, Cloning and
expression of cDNA encoding a new type of ascorbate per oxidase
from spinach, FEBS Lett., 367(1): 28-32 doi: 10.1016/0014-5793(95)
00539-L
Kubo A., Saji H., Tanaka K., and Kondo N., 1992, Cloning and sequencing
of a cDNA encoding ascorbate peroxidase from Arabidopsis thaliana,
PlantMol. Biol., 18(4): 691-701doi: 10.1007/BF00020011PMid: 1558944
Li J.D., and Yang Y.F., 2004, Combinatorial structures of plant species in
saline communities in the songnen plains of China, Caoye Xuebao
(Acta Pratacultural Science), 13(1): 32-38
Lin L., Wang X.P., and Wang Y.J., 2006, cDNA clone, fusion expressi on
and purification of the novel gene related to ascorbate peroxidase from
Chinese wild Vitis pseudoreticulata in
E. coli
, Mol. Biol. Rep., 33(3):
197-206 doi:10.1007/s11033-006-0008-5 PMid:16850189
Lu S.Q., Sun M., and Yu Z.N., 1998, The classify of Bacillus thuringiensis
strain's different ICP genes, Shengwu Gongcheng Jinzhan (Progress in
Biotechnology), 18(5): 57-58
Lu Z., Liu D., and Liu S., 2007, Two rice cytosolic ascorbate peroxidases
differentially improve salt tolerance in transgenic Arabidopsis, Plant
Cell Rep., 26(10): 1909-1917 doi: 10.1007/s00299-007-0395-7 PMid:
17571267
Ma C.L., Wang P.P., and Cao Z.Y., 2002, cDNA cloning and gene
expression of APX in Suaeda salsa in response to salt stress, Zhiwu
Shengli Yu Fenzi Shengwuxue Xuebao (Journal of Plant Physiology
andMolecular Biology), 28(4): 261-266
Mittler R., and Zilinskas B.A., 1991, Molecular cloning and nucleotide
sequence analysis of a cDNA encoding pea cytosolic ascorbate per
oxidase, FEBS Lett., 289(2): 257-259 doi: 10.1016/0014-5793(91)
81083-K
Miyazaki A., Kikuchi S., Satoh K., Nagata T., Kawagashira N., Doi K.,
Kishimoto N., Yazaki J., Ishikawa M., Yamada H., Ooka H., Hotta I.,
Kojirma K., Namiki T., Ohneda E., Yahagi W., Suzuki K., Li C.J.,
Ohtsuki K., Shishiki T., Otomo Y., Murakami K., Iida Y., Sugano S.,
Fujimura T., Suzuki Y., Tsunoda Y., Kurosaki T., Kodama T., Masuda
H., Kobayashi M., Xie Q., Lu M., Narikawa R., Sugiyama A., Mizuno
K., Yokomizo S., Niikura J., Ikeda R., Ishibiki J., Kawamata M.,
Yoshimura A.,Miura J.,Kusumegi T., OkaM., Ryu R., Ueda M.,
Matsubara K.R., Kawai J., Carninci P., Adachi J., Aizawa K., Arakawa
T., Fukuda S., Hara A., Hashizume W., Hayatsu N., Imotani K., Ishii
Y., Itoh M., Kagawa I., Kondo S., Konno H., Osato N., Ota Y., Saito