Page 9 - Genomics and Applied Biology

Genomics and Applied Biology, 2010, Vol.1 No.4
http://gab.sophiapublisher.com
- 33 -
Table 5 Specific primer pairs used for the multiplex RT-PCR
Primer name Genome position ★ Primer sequence (5' to 3') Expected product
1F 7437~7457 CCCCGCCAACCCCGAGAATAG
1R 7903~7926 AATCCCAAAGCGTGCCATCAATCC
490 bp (ORF1b)
2F 11003~11024 AGCCAGCCTTCGCCCTATCCAT
2R 11327~11347 GAAACCCCGACCACCGCAACT
345 bp (ORF1b)
3F 14729~14750 CCCGGGTTGAAAAGCCTCGTGT
3R 14933~14956 GGCTTCTCCGGGTTTTTCTTCCTA
228 bp (ORF7)
Note: ★ Position is marked according to the sequence of JX-3 strain (GenBank accession number EU200961)
was performed using TaKaRa one-step RT-PCR kit
(TaKaRa Biotechnology Co., Ltd, China). Three pairs
of primers were employed in one reaction. The
multiplex RT-PCR and the conventional single
RT-PCR (sRT-PCR) were compared at the same time
by testing each sample. The multiplex RT-PCR was
carried out in a reaction volume of 50 μL containing
0.5 μL of each primer (12.5 pmol/μL), 5 μL of 10×
one step RT-PCR Buffer, 5 μL 2.5 mmol/L dNTPs, 10
μL of 25 mmol/L MgCl2, 1 μL of RNase Inhibitor (40
U/μL), 1μL of AMV Reverse Transcriptase XL (5
U/μL), 1 μL of AMV- optimized Taq (5 U/μL) and 10
μL of each viral RNA. Amplification conditions
were an incubation at 50 for 30 min and an initial℃
denaturing at 94 for 2 min, and then followed by 30℃
cycles, which consisted of denaturing at 94 for 40 s,℃
annealing at 57 for 40 s, and extension at 72 for℃ ℃
50 s. The last extension step was performed at 72℃
for 8 mins, and then kept the reaction at 4 . Reaction℃
products were analyzed by agarose gel electrophoresis
and stained with ethidium bromide.
3.6 Sensitivity and specificity test
The sensitivity of the multiplex RT-PCR assay was
determined using 10-fold serial Marc-145 cell-adapted
cultures infected by CH-1a live virus with the titer of
105.0 TCID50. The specificity of the multiplex
RT-PCR was determined by testing different non-
PRRSV isolates related to high fever (≥40.5℃ ) and
reddened skin (including classical swine fever virus
(CSFV), swine vesicular disease virus (SVDV ) and
vesicular exanthema of swine virus (VESV).
3.7 Sequencing
The purified multiplex RT-PCR products (490 bp) and
the conventional sRT-PCR products (660 bp) by the
gel of 25 clinical samples were subjected to
sequencing (Takara, Dalian, China). The sequences
were analyzed using the DNAStar to confirm the
correction of the amplifications.
Author Contributions
Conceived the experiment and edited the manuscript: Liu
Xiangtao and Wu Jinyan. Data collection and analysis: Tian
Hong Chen Yan Shang Youjun Yin Shuanghui Zhao Na
Jin Ye and Xie Qingge. Wrote the manuscript: Wu Jinyan. All
authors have read the final version of this paper and agreed
with the authors’ credits.
Acknowledgements
This work was supported by the national “ 863 ” Key
Technology R＆DProgramme (Grant No.2006AA241110).
References
An T., Zhou Y., Liu G., Tian Z., Li J., Qiu H., and Tong G., 2007, Genetic
diversity and phylogenetic analysis of glycoprotein 5 of PRRSV
isolates in mainland China from 1996 to 2006: Coexistence of two
NA-subgenotypes with great diversity, Vet. Mic., 123(1-3): 43-52
doi:10.1016/j.vetmic.2007.02.025 PMid:17383833
Bao H.F., Li D., Guo J.H., Lu Z.J., Chen Y.L., Liu Z.X., Liu X.T., and Xie
Q.G., 2008, A highly sensitive and specific multiplex RT-PCR to detect
foot-and-mouth disease virus in tissue and food samples, Arch. Virol.,
153(1): 205-209 doi:10.1007/s00705-007-1082-y PMid:17987350
Cavanagh D., 1997, Nidovirales: a new order comprising Coronaviridae and
Arteriviridae, Arch. Virol., 142(3): 629-633
Chamblain J.S., Gibbs R.A., Renier I.E., Nguyen P.N., and Caskey C.T.,
1998,Deletion screening of the duchenne muscular dystrophy locus via
multiplex DNA amplification, Nucl. Acids. Res., 16(23): 11141-11156
doi:10.1093/nar/16.23.11141 PMid:3205741 PMCid:339001
Chen J., Liu T., Zhu C.G., Jin Y.F., and Zhang Y.Z., 2006, Genetic variation