Page 7 - BM 2011 Vol.2 No.3

Bioscience Methods
BM 2011, Vol.2, No.3 http://bm.sophiapublisher.com
- 18 -
DNA extraction kit were bought from TAKARA
company. Antibiotics, biochemistry and molecular
biological reagents were bought from Shanghai Bioen
gineering Company, Harbin Demei Biology Company
etc. Primers were synthesized by Beijing Aoke
Biotechnology Company. Other reagents were all
domestic analytically purity.
3.2 Extraction of plasmid, purification and preparation
of competent cell for E. coli
Plasmid DNA of E. coli and Agrobacterium were
extracted by alkali lysis method (Zhang et al., 2000);
the competent cells for the E. coli were prepared by
the CaCl2 method followed by the method of
Sambrook et al (1992).
3.3 Primer designed and synthesized
Two pairs of specific primers were designed based on
the conserved cry1Ac22 gene sequence and function
domain (Table 1), which were synthesized by the
Nanjing Jinsite Biotechnology Company. The restriction
enzyme site BamHⅠ was added in the forward primer,
the SalⅠ was added in the reverse primer.
Table 1 PCR primers
Genes Primers Sequences (5’- 3’)
Forward primer GGATCCATGGATAACAATCCGAACATC
cry1Ac22F Reverse primer GTCGACTGAGTTTGCATGAGACTATTC
Forward primer GGATCCATGGATAACAATCCGAACATC
cry1Ac22T Reverse primer GTCGACTTACGTAACTAAATTGG
Note: The restriction sites are underlined
3.4 Cloning of cry1Ac22F and cry1Ac22T
We respectively amplified the cry1Ac22F gene and
cry1Ac22T using the W015 -1 genomic DNA as
templates with specific primer. PCR procedure is as
following: 94℃ for 5 min in advance, 30 cycles of 94℃,
1 min, 54℃, 1 min and 72℃, 30 s, 72℃ , 10 min for
extension and then 4℃ until moved to use. The PCR
products were electrophoretically separated in the
agarose gel and then were recovered to ligate to the
pMD18-T vector. Two sequencing clones of cry1Ac22F
and cry1Ac22T were completed to be transformed into
the competent cell. The positive recombinants were
identified by the BamHⅠ and Sal Ⅰdigestion and then
were sequenced.
3.5 Construct of pBI121-Cry1Ac22F and pBI121-
Cry1Ac22T
pBI121 vector is a commonly plant expression vector
driven by the CaMV35S promoter with kanamycin
resistant gene. The recombinant plasmid of pMD18-
T-Cry1Ac22F and pBI121-Cry1Ac22T were digested
by the restriction enzymes BamHⅠ and SalⅠ. The
digested fragments were ligated into the pBI121
vector that was also digested with the same restriction
enzyme, and then were transformed into E. coli
JM109 and identified by the restriction enzyme. The
positive clones of pBI121- Cry1Ac22F and pBI121-
Cry1Ac22T were screened by the enzyme digestion.
Plant expression constructs of pBI121-Cry1Ac22F
and pBI121- Cry1Ac22T were showed as the figure 9
and figure 10.
Figure 9 Structure of the construct of pBI121-Cry1Ac22F
Figure 10 Structure of the construct of pBI121-Cry1Ac22T