FC_2025v8n1

Field Crop 2025, Vol.8, No.1, 20-31 http://cropscipublisher.com/index.php/fc 22 during surgery. At the least, it will affect the expected effect, and at the worst, it may produce some strange new traits. So now researchers are racking their brains to find ways to improve the accuracy of editing. After all, to truly apply this technology to breeding practice, we must first ensure that it is reliable enough. Table 1 The putative off-target event in the OsPIN5b, GS3, and OsMYB30triple mutant lines (Adopted from Zeng et al., 2020) Target Site Putative off-target site The sequence of putative offtarget site No.of plants No.of plants with mutations Mutation rate (%) OsPIN5b-Site1 Chr3:9566074-9566052 CCTCGAGCTCTGCAAGGCTTTGG 8 0 0 Chr1:19390027-19390049 TTTCGAGCTGCGCAAGGCGCGGG 8 0 0 OsPIN5b-Site2 Chr7:8747238-8747260 CTCGTGTGCGCCAACGTTCTCGG 8 0 0 Chr3:24251589-24251567 AACGTGCTCGTCAGCGTCCTCGG 8 0 0 GS3-Site1 Chr8:2495427-2495449 GACGCGCTCCACCGCGCGCTCGG 8 0 0 Chr7:14816697-14816719 AACTCGCTCAACCGCGAGAGGGG 8 0 0 GS3-Site2 Chr9:1832101-1832123 TCGCGCCACCCCACACGAGGTGG 8 0 0 Chr7:27472889-27472911 TAACCCCGCACCGCATGAGGCGG 8 0 0 OsMYB30-Site1 Chr3:13108929-13108951 GTGGCGGAGAGCGACTGCACGGG 8 6 75 Chr5:1475321-1475343 CTGCGCGAGAGCGACTGCGCCGG 8 0 0 OsMYB30-Site2 Chr4:24538627-24538649 TGACAAATGCTGCATGCCATGGG 8 0 0 Chr2:28909447-28909469 CGTCAAATTCTGCATGACAGTGG 8 0 0 Table caption: The green font represented the PAM motif (NGG);the red font represented the mismatch bases (Adopted from Zeng et al., 2020) To be honest, the biggest obstacle that CRISPR technology encounters in rice breeding may not be the technology itself, but the regulatory regulations. The attitudes of different countries towards gene-edited crops are very different-some countries give the green light, while others set up many barriers (Jaganathan et al., 2018). These regulations are no joke. Safety tests need to be done for several years at any time. By the time the approval process is completed, the new varieties may have missed the best promotion period. What is more troublesome is the acceptance of the general public. Although scientists think that gene editing and genetic modification are not the same thing, ordinary consumers don't care about these professional differences (Ansari et al., 2020). I remember that a few years ago, a team developed a new rice variety that was disease-resistant and high-yield, but it ended up rotting in the laboratory due to public resistance. So, no matter how good the technology is, it must pass the social recognition stage. It is not enough to succeed in the laboratory. 3 CRISPR Applications for Improving Stress Tolerance in Rice 3.1 Case studies on drought tolerance gene editing Recently, CRISPR technology has made new breakthroughs in rice drought resistance research, but the results are quite surprising. After scientists edited the OsSAP gene related to aging, they found that these rice plants were more vulnerable under drought conditions-their ability to remove harmful reactive oxygen species became worse, and their overall growth was not as good as that of ordinary rice (Park et al., 2022). As you can see from the data in Figure 1, all indicators have declined across the board, from survival rate to plant height, from root development to final yield. This proves that the OsSAPgene is like a "drought resistance switch" and plays a key role in resisting drought. Although this experiment seems to have failed, it actually helped us understand the drought resistance mechanism, and we will know which direction to work hard in the future when we want to cultivate drought-resistant varieties. This "reverse verification" method can be regarded as an unexpected gain brought by CRISPR technology. This time, scientists have set their sights on the OsPYL9 gene, which controls a "drought-resistant hormone" called ABA in rice. After the gene was modified using CRISPR technology, something magical happened: during drought, the ABA hormone in these rice plants rose sharply, with their own "antioxidant buff", and their survival rate was significantly improved (Usman et al., 2020). What's even more surprising is that through proteomic analysis, it was found that these mutants not only had upgraded drought resistance, but also optimized their

RkJQdWJsaXNoZXIy MjQ4ODYzNA==