Bioscience Method 2024, Vol.15, No.1, 1-8 http://bioscipublisher.com/index.php/bm 3 Table 1 Primers sequences of RPA amplification Name Sequence (5'-3') E7-RPA-80F CATTTACTGGGAGTTATGAAACTGGTAA E7-RPA-80R AGAAATTTGGAAACAAACCTTAACCATAG E7-RPA-122F GATATTCCTCTCAATACATGGTTTATGTTT E7-RPA-122R AGAAATTTGGAAACAAACCTTAACCATAG E7-RPA-214F AATGATATTCCTCTCAATACATGGTTTAT E7-RPA-214R AATTCTAAAAAGTAAAGGAGTTAAAAGAAAAG In order to verify the accuracy of the designed RPA primers for detecting badh2-E7, the japonica rice restoration line Shen CR1 (variety right number: CNA20191001690) selected by our research group containing the badh2-E7 aroma allele gene was used as the positive control, while the japonica rice restoration line Shen Hui 26 without the badh2-E7 aroma allele gene was used as the negative control. The leaf DNA of Shen CR1 and Shen Hui 26 were extracted using the CTAB method, and amplified using three pairs of designed RPA amplification primers. The agarose gel electrophoresis results showed that E7-RPA-80 only had specific DNA fragments in Shen Hui 26 without Badh2-E7, while there were no amplification products in the variety Shen CR1 containing Badh2-E7 (Figure 2). E7-RPA-122 and E7-RPA-214 have specific DNA amplification fragments in both fragrant and non fragrant rice. Compared to E7-RPA-214, E7-RPA-122 has better polymorphism (Figure 2), therefore E7-RPA-122 was selected as the marker for testing the Badh2-E7 allele. Figure 2 Quality verification of RPA amplification primers Note: M: DL2000 Marker; P1: Shen CR1; P2: Shenhui 26 1.2 Sensitivity analysis of RPA amplification technology for detecting badh2-E7 Dilute the initial concentration of leaf DNA extracted from the japonica rice restoration line Shen CR1 containing the Badh2-E7 aroma allele and the japonica rice restoration line Shen Hui 26 without the Badh2-E7 aroma allele to 10 ng/μL. Then dilute the DNA with a 10 fold gradient. Perform amplification using conventional PCR and RPA methods respectively, and compare the sensitivity of the two methods. The results showed that the lowest detectable DNA template concentration for PCR technology was 10-2 ng/μL. The lowest detectable DNA template concentration for RPA amplification technology is 10-4 ng/μL. The sensitivity of RPA amplification technology is about 100 times that of PCR technology (Figure 3).
RkJQdWJsaXNoZXIy MjQ4ODYzMg==