Basic HTML Version
International Journal of Aquaculture, 2013, Vol.3, No.24, 138
-
146
http://ija.sophiapublisher.com
145
3.2 DNA Extraction
Total DNA was isolated by standard proteinase K,
phenol/chloroform extraction (Sambrook et al., 1989).
Quantity and quality of the DNA samples were
estimated by comparing band intensities on a 0.8%
agarose gel and by a spectrophotometeric method.
3.3 RAPD Analysis
In total 12 decamer RAPD primers were screened and
only eight primers (Table 1) were found to efficiently
generate the polymorphism. PCR was performed in a
volume of 20 µl containing: 10x Taq DNA
polymerase buffer, 2.25 mM MgCl
2
, 0.2 mM of dNTP
mix, 0.36 µM of each primer (Sigma Aldrich, USA),
0.4ng genomic DNA, and 1 unit of Taq DNA
polymerase (Sigma Aldrich, USA). A control PCR
tube containing all components but no genomic DNA
was run with each primer to check any contamination.
DNA amplification was performed in Master Cycler
Gradient (Eppendorf, Germany). After initial
incubation for 5 min at 94
℃
, the samples for
enzymatic amplification were subjected to 45 repeats
of the following thermal cycle: 1 min 94
℃
, 1min at
36
℃
and 1 min at 72
℃
, and the final extension at 72
℃
for 5 min. After amplification, the reaction
products were subjected to electrophoresis in 1.5%
agarose gels in 1x TAE buffer at 5 V/cm, stained with
ethidium bromide and photographed under UV light
with the help of Gel documentation system
(Alpha-Innotech, USA). A Gene Rular
TM
DNA Ladder
Mix (Bangalore Genei, India) was used as the
molecular standard. All the PCR results were tested
for reproducibility by at least three times. Bands that
did not show fidelity were eliminated.
3.4 PCR-RFLP
The Cytb
gene of mtDNA were amplified using two
designed forward and reverse primers with following
sequences 5’-GTTTGATCCCGTTTCGTGTA- 3’ and
5’- AATGACTTGAAGAACCACCGT -3’ (Briolay et
al,
1998). PCR was performed in a volume of 50
μ
L
containing 10× reaction buffer, 2 mM dNTPs, 1.5 mM
MgCl
2,
0.5
μ
M of each primer, 0.5 units Taq
polymerase, and approximately 200 ng DNA template
(Sigma Aldrich, USA). The reaction mixtures were
incubated in Master Cycler Gradient (Eppendorf,
Germany). Thermal cycling comprised of 95
℃
for 3
min, followed by 34 cycles of 95
℃
for 30 sec.
annealing at 55
℃
for 30 sec and an extension
temperature of 72
℃
for 1 min. This was followed by
a final extension of 72
℃
for 5 min. Following
restriction endonucleases were used for DNA
digestion: MboI, BsuI, MspI, Hin6I (Fermentas,
Germany). The digestion was carried overnight
following manufacturer’s instructions
(Table 3)
.
Restricted DNAs were electrophoresed on 1.5%
agarose gels run at 5 V/cm in 1XTAE buffer, stained
with ethidium bromide and photographed under UV
light with help of Gel documentation (Alpha Innotech
Cell Biosciences). Gene Rular
TM
1Kb DNA Ladder
and Gene Rular
TM
(Bangalore Genei, India) 100 bp
plus was used as the molecular standards. All the PCR
and restriction digestion results were tested for
reproducibility.
3.5 Data analysis
For RAPD and PCR-RFLP polymorphic, reproducible
amplification/ restriction products were scored as:
present (1) or absent (0). Genetic diversity was
estimated by the Shannon index (Lewontin, 1972):
Where K is the number of bands produced with the
respective primer/restriction enzyme and pi is the
frequency of the i-th fragment. To further investigate
phonetic relationships among species, the binary
matrix was used to cluster individuals using procedure
of NTSYS-pc 8.1 (Rohlf, 1993), which uses the
unweighted pair group method with arithmetic
averages (UPGMA). The estimates of pairwise genetic
distance between 75 cyprinid species was based on
Jaccard’s similarity coefficient. The ARLEQUIN
version 3.1 program (Excoffier et al., 2005) was
used to evaluate the variability within populations
by haplotype and nucleotide diversity (Nei and
Tajima, 1981). Quantitative estimate of mtDNA
diversity was performed using ANOVA technique
(Excoffier et al., 1992).
Acknowledgements
The authors are highly thankful to the Department of Science and
Technology, New Delhi, India for their financial support.
The help of P. M.
Iqbal for
technical assistance
is also greatly acknowledged. We appreciate the
help and support provided by Prof. Shafiq Ahmad Wani, Director Research,
SKUAST-K-India.
References
Ahmed M.M.M., Ali B.A., and EI-Zaeem S.Y., 2004, Application of RAPD
markers in fish: Part I – some genera (
Tilapia, Sarotherodon
and
Lnpi
pi
H
k
i
∑
=
−=
1